Featured Posts

Fcc Lainc Rss

Heme Degradation Enzyme Biliverdin Ixβ Reductase Is Required For Stem Cell Glutamine Metabolism

Posted on : 01-08-2018 | By : loopers jaret | In : Uncategorized

0

Bioenergetic requirements of hematopoietic stem cells (HSC) and pluripotent stem cells (PSC) vary with lineage fate, and cellular adaptations rely largely on substrate (glucose/glutamine) availability and mitochondrial function to balance TCA (tricarboxylic acid)-derived anabolic requirements, redox homeostasis, and reactive oxygen species (ROS) [1]. These adaptations are especially relevant to pluripotent stem cells which maintain a balance between metabolically quiescent, non-cycling (ROSlow) cells in the hypoxic bone marrow niche and a metabolically active (ROShigh) phenotype associated with the switch to aerobic (oxidative phosphorylation) metabolism and proliferation. ROS accumulation promotes lineage-restricted hematopoietic development [2], although ROS generation exceeding the capacity of cellular antioxidant mechanisms promotes senescence and apoptosis. Mitochondria and NADPH oxidase are the primary sources of ROS generation [3], and oxidation of glucose and glutamine via the mitochondrial tricarboxylic acid (TCA) cycle provides the critical source of biosynthetic precursors required for cellular proliferation. Quiescent stem cells largely depend on glycolysis for ATP synthesis, and glutamine oxidation is indispensable for survival of pluripotent stem cells [4], serves as a crucial mitochondrial substrate for cancer cells [5], and regulates human hematopoietic stem cell lineage specification [6]. Similarly, since the NAD+/NADH ratio is regulated by glycolytic and mitochondrial activities that change dramatically during differentiation or reprogramming [7], the NAD+/NADH redox state may have a role in driving pluripotent stem cell fate.

Heme (protoporphyrin IX complexed with iron) serves as an indispensable co-factor for all aerobic cells, providing the prosthetic group for phylogenetically-distinct hemoproteins functioning in the electron transport chain (ETC), gas exchange, or as light-sensing plant or bacterial phytochromes [8]. Heme biosynthesis is initiated by the condensation of TCA-derived succinyl CoA and glycine, whose generation from serine provides 1-carbon units coupled to the folate cycle for purine and thymidine biosynthesis [9]. The cytotoxicity of free heme is minimized by a two-step catabolic reaction initiated by heme oxygenases (HMOX1 and HMOX2), with sequential generation of biliverdin (BV) and bilirubin (BR) tetrapyrroles in a major pathway functioning in cellular defenses against oxidative and nitrosative stress [10], [11]. BV to BR derivatization is regulated by two non-redundant biliverdin reductases (BLVRA and BLVRB), differing by their isomeric specificity in NAD(P)H-dependent oxidation/reduction (redox) coupling. BLVRA retains specificity for the predominant BV found in adults (BVIXα) with less efficient utilization of BV IXβ, IXγ, or IXδ [12, 13], while BLVRB is promiscuous, catalyzing the NAD(P)H-dependent reduction of non-IXα BVs [14], several flavins [15], and pyrroloquinoline quinones (PQQ) [16]. Thus, heme synthesis and degradation converge in a linear pathway that utilizes TCA cycle-derived carbon in cataplerotic reactions ultimately linked to bilirubin generation and cellular antioxidant functions [17].

Preferential reliance on glycolytic pathways is a common bioenergetic feature of PSC and cancer metabolism despite low efficient ATP generation [1, 5], and both PSCs and cancer cells reside in hypoxic niches and rely on glutamine metabolism for survival and growth [4, 5]. The overlapping glucose/glutamine requirements for both heme biosynthesis and PSC substrate utilization suggested that dysregulated heme metabolism would affect bioenergetics utilization. We focused on BLVRB because of its acknowledged activity in early fetal development [14], coupled with recent evidence for a redox-regulated function governing hematopoietic lineage fate [18]. Bioavailable NMN

Materials

All regents were of the highest purity commercially available. Biliverdin was purchased from Frontier Scientific, Inc. (Logan, UT); bilirubin, NADPH and FMN (flavin mononucleotide) were purchased from Sigma-Aldrich. High-performance liquid chromatography (HPLC) grade acetonitrile, methanol, and water were purchased from Burdick & Jackson (Morristown, NJ).

Bioethical studies using induced pluripotent stem cells

Studies using induced pluripotent stem cells (PSCs) were approved by the Stony Brook IRB (Institutional Review Board) in accordance with the Declaration of Helsinki [19].

Genome editing in PSCs

Induced pluripotent stem cells (PSC) derived from CD34+ human umbilical cords (NCRM1) were obtained from the NIH Center for Regenerative Medicine and propagated on matrigelcoated surfaces under normoxic conditions in feeder- and serum-free cell culture medium (mTeSR, Stem Cell Technologies; Vancouver, British Columbia). Single guide RNA (sgRNA) oligonucleotides were designed using the clustered regularly interspaced short palindromic repeats (CRISPR) Design Tool (http://crispr.mit.edu/) to minimize off-target effects, and selected to precede a 5’-NGG protospacer-adjacent motif (PAM). sgRNAs used in this study were synthesized to target BLVRB exon 3 nucleotides 430-449 (RefSeq ID NM_000713.2) contiguous to Serine 111, sequence as follows: sgRNA1: 5’ TCATGGTGTGGACAAGGTCG 3’; control sgRNA 5’-GTAGCGAACGTGTCCGGCGT-3’. Oligonucleotides were annealed and cloned into the BbsI site of the S. pyogenes Cas9 (SpCas9) nuclease (plasmid PX458; Addgene, Cambridge, MA), thereby allowing for transfection monitoring using green fluorescent protein (GFP) detection.

NCRM1 transfection was completed using lipofectamine 3000 (Life Technologies), and GFP+ cells were sorted and collected by flow cytometry for expansion and further characterization. Putative off-target effects were excluded by RNASeq and detailed sequence alignments of the top 50 sites predicted for the guide sequence (http://crispr.mit.edu).