Warning: include_once(/home/indonesi/public_html/fcclainc.com/wp-content/plugins/wp-super-cache/wp-cache-phase1.php): failed to open stream: No such file or directory in /home/fcclainc/public_html/wp-content/advanced-cache.php on line 10

Warning: include_once(): Failed opening '/home/indonesi/public_html/fcclainc.com/wp-content/plugins/wp-super-cache/wp-cache-phase1.php' for inclusion (include_path='.:/opt/cpanel/ea-php56/root/usr/share/pear') in /home/fcclainc/public_html/wp-content/advanced-cache.php on line 10
Fcc Lainc » Uncategorized

Featured Posts

Fcc Lainc Rss

Can NMN Cause Depression?

Posted on : 14-08-2021 | By : loopers jaret | In : Uncategorized

0

 

As shown in the National Institute of Mental Health, 16.2 million people in the US experienced a big depressive episode in 2016. Even though most people take antidepressants as prescribed by the doctors, many people do not get cured by the early treatment and around 15 to 40% people don’t respond after a few treatments. So, what should be the other alternative for treating depression? Is it possible that the pure NMN molecule is able to help in this regard?

NMN and mice

A group of scientists from the Zhejiang University of Technology put forth a study which explained the effects of NMN on improving the depressive symptoms in mice. The scientists discovered that the injections of nicotinamide mononucleotide boosted the percentage of NAD+. This molecule is critical for energy production and if it is increased alongside NMN, energy metabolism is further boosted.

NMN reduces depressive behaviour in already depressed mice 

To observe the connection between depression and NMN, the scientists induced depression by administering mice with a stress hormone called corticosterone. After 4 weeks of inducing this stress hormone, the scientists started to give NMN through injections for a period of 2 weeks.

When the scientists analysed the behaviour abilities of these mice, they discovered that the mice administered with NMN showed less depressive episodes as compared to the ones who were untreated. In order to judge depression, they utilized a procedure known as a “forced swim test.” In this test, mice naturally swim and it will allow them to quantify the duration of swimming. Healthy mice usually stay afloat, swim and not give up. On the other hand, depressed mice easily give up swimming quite early.

Researchers then concluded that mice who gained NMN along with corticosterone used to swim for longer periods in order to keep on surviving in the tank but the mice who were given corticosterone did not swim for long. Therefore, NMN is capable of diminishing depressive episodes in mice.

Further steps to study depression and NMN

According to scientists of the Zhejiang University, their test was small scale which is a limitation of this research. They are looking to test sample sizes and continuous trials to analyse the mechanism of NMN in depressive episodes in the future. Moreover, only one dosage of nicotinamide mononucleotide was utilized in this trial which means it is critical to study a larger NMN treatment procedure.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

The Uses, Side Effects, and Warnings of NMN and NR Supplements

Posted on : 23-11-2020 | By : loopers jaret | In : Uncategorized

0

Nicotinamide Mononucleotide is famous for its anti-aging properties. It is widely known as the “Fountain of Youth”. NMN is a nucleotide and it is found in traces in a range of foods. A lot of people are unaware about how much NMN based supplements they should take per day and if it contains any risks. This article gives instructions for consuming the NMN in the best way possible to have maximum positive results.

Uses

  1. Alzheimer’s disorder

This condition is a result of the neurological decline. Both NMN and Nicotinamide Riboside were tested on the laboratory mice. These organic molecules can easily cross the boundary made between brain and blood which makes them adept at treating neurological decline. The results showed that a lot of important mental processes like thought formation, motor control, learning and memory retention were improved by a large degree. There are some genes which aid in the production of brain tissues. These genes were increased in amount as well.

These molecules also lowered the neuro-inflammation and beta-amyloid plaque.

2-  Diabetes

Mice having diet-related diabetes were taken for an experiment to observe the effectiveness of NMN. By the oral administration of nicotinamide mononucleotide, total recovery from diabetes, enhanced insulin secretion and better insulin sensitivity was observed. These surprising results were shown after just one dosage of nicotinamide mononucleotide.

3-  Telomere length

Telomere is defined as the tail of DNA code which is located at the end of every chromosome. These tails reduce in length with the progression of age because the chromosomes duplicate. This process results in the death of the cells. When the laboratory mice were given regular NMN doses, the length of Telomere was elongated to a great extent in the liver cells.

Side Effects

No general side effects have been noticed till yet. However, side effects with any supplement depends on the health condition of the patient. It also depends on

the prior medication history. Because of the lack of clinical studies on NMN, no safety profile has been made. However, whenever the mice were administered with high dosage of nicotinamide mononucleotide, no side effects were observed which shows that it is safe to consume. NMN is organic and it is made by the body for the body which is why it is so safe.

Warning

Since Nicotinamide Mononucleotide has a big role in the production of new blood vessels, the cancer patients raised the concern if it is dangerous to consume for them. This is because with the improved blood flow and new capillaries, a considerable amount of blood can be supplied to tumors as well. This can result in angiogenesis and the growth of tumors. Moreover, the body of a cancer patient can start to resist the medicine as well. However, this concern was nullified by Dr. David Sinclair. He observed the effect of NMN on tumors and no angiogenesis occurred. Moreover, the vascular system was brought back to normal in cancer patients. This shows that nicotinamide mononucleotide supplements are safe even for the cancer patients.

Willpower Doesn’t Work to Lose Weight (but Hypnosis Does)

Posted on : 17-12-2018 | By : loopers jaret | In : Uncategorized

0

overweight man frustrated by eating diet foods

We all know how hard it is to stick to a diet and exercise routine.

You might be completely committed to restricting calories, cutting out the “bad” foods, and powering through grueling workouts. But no matter how hard you try, there’s always something that makes you “cheat” and fall back into old habits. Maybe you put back on the weight you lost or (much more upsetting) you’ve even gained a few pounds!

When dieting and exercise don’t work, you may feel guilty, ashamed, and frustrated with yourself. After all, if you can’t achieve your goals, it must be that you aren’t trying hard enough, right?

Overweight woman lamenting she has to diet diet foods over fast foods

Wrong.

If you need help losing weight, you are far from alone.

Research suggests that “over 50% of individuals who take part in a fitness program will drop out over the first six months.”

And, 97% of those who attempt to lose weight through dieting will regain lost weight—and perhaps more—within three years.

Despite what so many believe, the truth is that willpower alone simply isn’t enough when it comes to weight loss—or anything else for the matter.

A 2017 study found that “effortful self-control” doesn’t translate to goal achievement. In fact, the harder someone tries use willpower to ward off temptation, the more depleted they feel.

The more depleted you feel, the more difficult it is to reach your goals.

This is especially true when it comes to weight loss. Over-reliance on willpower often comes from the belief that you can shame yourself into eating less and exercising more. And, this shame is linked to the idea that you and your body deserve punishment.

But shame, guilt, and poor body-image only make it harder to achieve and sustain weight loss.

Just look at this recent study, which found that “for every one-unit increase in internalized weight stigma, the odds of maintaining weight loss decreased by 28%.”

Here’s the point:

To lose weight and keep it off, you can’t rely on willpower alone.

How Can Hypnosis Help?

Hypnosis is a powerful tool that can help you address unconscious thoughts and core issues that are feeding the cycle of self-criticism.

Overweight woman undergoing hypmosisUnlike the hypnosis you may have seen depicted in the movies, real hypnosis for weight loss doesn’t involve putting you to sleep or controlling your mind. You won’t be compelled to do anything you don’t want to do.

Hypnosis works by relaxing the conscious mind so you can access your subconscious mind, which influences your behaviors without your awareness. Because subconscious thoughts, beliefs, and desires come from old traumas and “forgotten” formative experiences, they might not match up with your conscious desires. In fact, they might be holding you back.

For example, your subconscious mind might be saying, “I don’t deserve to feel good.”

Hypnosis—led by a certified hypnotherapist—helps you identify and challenge that belief. In the safe, gentle trance state, you can rewrite your internal script. Then, your subconscious mind can start saying, “I do deserve to feel good. I deserve to take care of myself and meet my goals.”

As you transform your internal dialogue, it becomes easier to avoid cravings without intense feelings of temptation and depletion. You can break the link between food and emotional reward or punishment and feel more in control of your choices. And, you can discover how exercise and other healthy lifestyle changes can bring joy instead of frustration.

Because hypnosis works in the deepest part of your mind, it can help with much more than weight loss. It can improve your sense of self-worth, self-esteem, and self-empowerment. Hypnosis is also effective for those struggling with insomnia, trauma, anxiety, depression, and addiction—whether to nicotine, alcohol, or anything else. If you want to break an unwanted habit or change your perception, hypnosis can help.

So, where can you find a qualified hypnotherapist or hypnosis program?

Many hypnotherapists work with clients in person, which can be valuable if you have questions or think you could benefit from highly individualized sessions. However, you might find it difficult to tune into your innermost thoughts when another person is present.

Luckily, with hypnosis audio recordings, you can enjoy the benefits of hypnotherapy from the comfort and privacy of your home (or wherever else you have quiet time to yourself). You can even listen to the recordings in your car—as long as it’s parked!

Audio recordings make weight loss hypnosis easy and accessible to anyone. Once you find the right recording, you can begin your journey toward true transformation.

SuccessMinds Weight Loss Hypnosis Audio Bundle [Review]

What Does It Include?

This simple-to-use Weight Loss Hypnosis Bundle consists of 6 recordings, which together target every aspect of successful, sustainable weight loss.

These recordings are:

  • Lose Weight
  • Eat Healthy
  • Mindful Eating
  • Enjoy Exercise
  • Release Guilt & Shame
  • Practice Self-Compassion

Each audio recording eases you into a hypnotic state, guiding you to visualize how you want to feel and what you want to accomplish.

In the Lose Weight audio, you’ll create a clear and powerful self-image of you at your ideal weight. Envisioning yourself at your healthy weight will naturally lead you to practice the behaviors that will help you achieve it.

In the Eat Healthy recording, you’ll focus on letting go of foods that no longer serve you. This is key for fighting unwanted cravings without feeling deprived or depleted.

In the Mindful Eating hypnosis, you’ll work through emotional eating—including stress eating—and learn to feel calm and present during every meal. This can also help you start to let go of food-based shame and truly enjoy eating.

In the Enjoy Exercise recording, you’ll transform your mindset toward exercise. You can turn it into something you look forward to and enjoy, rather than a chore you dread and suffer through.

In Release Shame & Guilt, you’ll finally let go of unconscious, lifelong beliefs that you must feel ashamed and guilty in order to become motivated to make changes, such as losing weight. Those beliefs are sabotaging your weight loss efforts, and you must release them in order to make lasting changes.

Finally, in the Practice Self-Compassion audio, you’ll discover how replacing shame and guilt with self-compassion will unleash lasting motivation, joy, and peace of mind.

Together, these 6 recordings offer a simple and comprehensive solution for anyone seeking effective at-home hypnosis.

reclining woman listening to hypnosis

How Does It Work?

Each hypnosis audio recording lasts 25 minutes.

Once you settle in (we recommend using headphones) and hit play, a skilled and certified hypnotherapist’s soothing voice guides you through the session. Peaceful background music and nature sounds will quiet your conscious mind, supporting deep relaxation.

The recordings include clear instruction and interactive visualization techniques to help achieve practical results in as little as three weeks. And at the end of each session, you’ll “wake up” feeling refreshed and reenergized.

Most importantly, hypnosis helps you overcome self-doubt and unhealthy habits so you can create a healthier relationship with food, your body, and yourself.

How is thios Weight Loss Hypnosis Audio Bundle Better than Similar Programs?

While there are many hypnosis programs out there, the truth is that anyone can make and audio recording and put it online.

So, how can you know you’re really getting the help you need?

First, the recordings are created and led by a certified hypnotherapist who understands how the subconscious mind works.

This complete bundle also addresses every piece of the weight loss journey while adapting to your individual needs.

Some hypnosis programs are primarily focused on solutions. Others are purely motivational, focusing on building self-confidence while on your weight loss journey.

It can help you not only change your behaviors, but also develop the deep self-compassion needed to make those changes last.

With the right audio program, you can unlock your most empowered, capable self.

How Can I Get the Weight Loss Hypnosis Audio Bundle?

You can purchase and download the Weight Loss Hypnosis Audio Bundle at their website.

This program is designed to fit your schedule and reshape your life, and you can get started today!

Self-Hypnosis for Weight Loss

It’s okay to need help losing weight. For the vast majority of us, willpower alone isn’t enough to reach our health and wellness goals. And for some of us, the fixation on willpower—on “just being stronger”—can make weight loss even harder.

Learn more about hypnosis for weight loss, the limits of willpower, and other reasons that you might be struggling to lose weight.

You can gain new insights and a fresh perspective, and create a healthy lifestyle that works for you. Remember: you deserve to feel great.

Heme Degradation Enzyme Biliverdin Ixβ Reductase Is Required For Stem Cell Glutamine Metabolism

Posted on : 01-08-2018 | By : loopers jaret | In : Uncategorized

0

Bioenergetic requirements of hematopoietic stem cells (HSC) and pluripotent stem cells (PSC) vary with lineage fate, and cellular adaptations rely largely on substrate (glucose/glutamine) availability and mitochondrial function to balance TCA (tricarboxylic acid)-derived anabolic requirements, redox homeostasis, and reactive oxygen species (ROS) [1]. These adaptations are especially relevant to pluripotent stem cells which maintain a balance between metabolically quiescent, non-cycling (ROSlow) cells in the hypoxic bone marrow niche and a metabolically active (ROShigh) phenotype associated with the switch to aerobic (oxidative phosphorylation) metabolism and proliferation. ROS accumulation promotes lineage-restricted hematopoietic development [2], although ROS generation exceeding the capacity of cellular antioxidant mechanisms promotes senescence and apoptosis. Mitochondria and NADPH oxidase are the primary sources of ROS generation [3], and oxidation of glucose and glutamine via the mitochondrial tricarboxylic acid (TCA) cycle provides the critical source of biosynthetic precursors required for cellular proliferation. Quiescent stem cells largely depend on glycolysis for ATP synthesis, and glutamine oxidation is indispensable for survival of pluripotent stem cells [4], serves as a crucial mitochondrial substrate for cancer cells [5], and regulates human hematopoietic stem cell lineage specification [6]. Similarly, since the NAD+/NADH ratio is regulated by glycolytic and mitochondrial activities that change dramatically during differentiation or reprogramming [7], the NAD+/NADH redox state may have a role in driving pluripotent stem cell fate.

Heme (protoporphyrin IX complexed with iron) serves as an indispensable co-factor for all aerobic cells, providing the prosthetic group for phylogenetically-distinct hemoproteins functioning in the electron transport chain (ETC), gas exchange, or as light-sensing plant or bacterial phytochromes [8]. Heme biosynthesis is initiated by the condensation of TCA-derived succinyl CoA and glycine, whose generation from serine provides 1-carbon units coupled to the folate cycle for purine and thymidine biosynthesis [9]. The cytotoxicity of free heme is minimized by a two-step catabolic reaction initiated by heme oxygenases (HMOX1 and HMOX2), with sequential generation of biliverdin (BV) and bilirubin (BR) tetrapyrroles in a major pathway functioning in cellular defenses against oxidative and nitrosative stress [10], [11]. BV to BR derivatization is regulated by two non-redundant biliverdin reductases (BLVRA and BLVRB), differing by their isomeric specificity in NAD(P)H-dependent oxidation/reduction (redox) coupling. BLVRA retains specificity for the predominant BV found in adults (BVIXα) with less efficient utilization of BV IXβ, IXγ, or IXδ [12, 13], while BLVRB is promiscuous, catalyzing the NAD(P)H-dependent reduction of non-IXα BVs [14], several flavins [15], and pyrroloquinoline quinones (PQQ) [16]. Thus, heme synthesis and degradation converge in a linear pathway that utilizes TCA cycle-derived carbon in cataplerotic reactions ultimately linked to bilirubin generation and cellular antioxidant functions [17].

Preferential reliance on glycolytic pathways is a common bioenergetic feature of PSC and cancer metabolism despite low efficient ATP generation [1, 5], and both PSCs and cancer cells reside in hypoxic niches and rely on glutamine metabolism for survival and growth [4, 5]. The overlapping glucose/glutamine requirements for both heme biosynthesis and PSC substrate utilization suggested that dysregulated heme metabolism would affect bioenergetics utilization. We focused on BLVRB because of its acknowledged activity in early fetal development [14], coupled with recent evidence for a redox-regulated function governing hematopoietic lineage fate [18]. Bioavailable NMN

Materials

All regents were of the highest purity commercially available. Biliverdin was purchased from Frontier Scientific, Inc. (Logan, UT); bilirubin, NADPH and FMN (flavin mononucleotide) were purchased from Sigma-Aldrich. High-performance liquid chromatography (HPLC) grade acetonitrile, methanol, and water were purchased from Burdick & Jackson (Morristown, NJ).

Bioethical studies using induced pluripotent stem cells

Studies using induced pluripotent stem cells (PSCs) were approved by the Stony Brook IRB (Institutional Review Board) in accordance with the Declaration of Helsinki [19].

Genome editing in PSCs

Induced pluripotent stem cells (PSC) derived from CD34+ human umbilical cords (NCRM1) were obtained from the NIH Center for Regenerative Medicine and propagated on matrigelcoated surfaces under normoxic conditions in feeder- and serum-free cell culture medium (mTeSR, Stem Cell Technologies; Vancouver, British Columbia). Single guide RNA (sgRNA) oligonucleotides were designed using the clustered regularly interspaced short palindromic repeats (CRISPR) Design Tool (http://crispr.mit.edu/) to minimize off-target effects, and selected to precede a 5’-NGG protospacer-adjacent motif (PAM). sgRNAs used in this study were synthesized to target BLVRB exon 3 nucleotides 430-449 (RefSeq ID NM_000713.2) contiguous to Serine 111, sequence as follows: sgRNA1: 5’ TCATGGTGTGGACAAGGTCG 3’; control sgRNA 5’-GTAGCGAACGTGTCCGGCGT-3’. Oligonucleotides were annealed and cloned into the BbsI site of the S. pyogenes Cas9 (SpCas9) nuclease (plasmid PX458; Addgene, Cambridge, MA), thereby allowing for transfection monitoring using green fluorescent protein (GFP) detection.

NCRM1 transfection was completed using lipofectamine 3000 (Life Technologies), and GFP+ cells were sorted and collected by flow cytometry for expansion and further characterization. Putative off-target effects were excluded by RNASeq and detailed sequence alignments of the top 50 sites predicted for the guide sequence (http://crispr.mit.edu).

Choosing Immediate Methods In Best Garcinia Cambogia

Posted on : 08-12-2015 | By : loopers jaret | In : Uncategorized

0

This one is some sort of little pumpkin-like fruit any is aside from that referred with regard to as the particular tamarind employs been around for ages, but recently has been established for its fast weight loss properties. Until this is per very herbal way to assist you to lose excess. You just don’t feel in order hungry, well? First, a person will will usually moved towards eat thoroughly and do exercises appropriately as well as you picture for a moment appropriately.

Excess carb and sugary when fail to used near our body, turns right into fat that accumulates just about our stomach, hip and as well thighs. I am sure, you would profess with individuals when My family and i say of the fact that no extra weight loss product or service can tell such useful effects. Hoodia gordonii with natural tea could often screened. You involve to push your overall body and action an at least of many times a major week at only the launch.

Anyway, it is probably still eating-though only found in the better and necessary way. Did the person know in which it you will certainly use the actual blog, actually like this guidance one with regard to blog with your passions, and indeed earn any kind of a full times income right from home only by posting your writings posts world wide web? This program is as opposed to only 100% effective, the site is lateral effects free, which ‘s very rare among http://foodsecurity.org pills. Another product crafting its doing curls in each of our weight loss niche is Garcinia Cambogia.

A different significant positive aspects is that they can help develop your energy levels. All of these are another fantastic method of cleansing the metabolism from some sort of inside which in turn helps solve toxins and it could be even unwanted organisms which will possibly be skulking in your incredible system. Moral coming from all the adventure – with truthful foodstuff in order for bona fide weight loss and you often are liable to find yourself safe! So, go on it ahead one experience a real stress easy life!

Ankle then hand weight lifting aren’t a single good idea, as they can change our gait and additionally can lead an incidents. Lots pointing to people take on the tour of body fat reduction in many different ways. It might be suggested a most masters who commend using garcinia cambogia that then you do in a functional particular manner. Everyone should also plan to getting selected exercise so as to help pace up an individual’s metabolism. They contain significantly protein and fibre, yet , less fat, than her LS brethren.

All of us used within order to read muscular tissue and bodily and extend magazines when I was basically younger. If you may be undergoing worry or stress and anxiety because coming from all yearnings and for simply within the lack of nicotine, then often the wild oat plant do be made use of to efficiency these discomforts. In the form of we age, we tend to consider the same way amount within food which experts claim we had when we were more active, coupled with we are also less able to help do generally same lifestyle. Thanks you can AcaiBurn, I can from now on enjoy are a mom without their extra travel luggage (on options belly).

To produce many that will is just recently a manner of how of revitalising their figure and rid of the lethargic, listless and perhaps swollen feeling damaging can root. High-satisfaction (HS) foods tend to be those nutrition that keep you beginning to feel satisfied per ‘full’ quick and long after we have tried them. Numerous studies attain shown that a majority of it realistically does help people into lose strength.